After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human FGG Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC007044.1
Размер кДНК:1314bp
Описание кДНК:Full length Clone DNA of Homo sapiens fibrinogen gamma chain.
Синоним гена:FGG
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12039-ACGRBS15400
Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12039-ACRRBS15400
Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12039-CFRBS13340
Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12039-CHRBS13340
Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12039-CMRBS13340
Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12039-CYRBS13340
Human FGG Gene cDNA clone plasmidHG12039-GRBS3620
Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12039-NFRBS13340
Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12039-NHRBS13340
Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12039-NMRBS13340
Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12039-NYRBS13340
Человек Fibrinogen gamma chain Джин клон кДНК в вектор клонированияHG12039-URBS5130
Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмидыHG12039-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12039-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».