Быстрый заказ

Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human FGG Информация о продукте «Клон cDNA»
Размер кДНК:1314bp
Описание кДНК:Full length Clone DNA of Homo sapiens fibrinogen gamma chain with C terminal His tag.
Синоним гена:FGG
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12039-ACGRBS15400
Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12039-ACRRBS15400
Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12039-CFRBS13340
Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12039-CHRBS13340
Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12039-CMRBS13340
Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12039-CYRBS13340
Human FGG Gene cDNA clone plasmidHG12039-GRBS3620
Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12039-NFRBS13340
Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12039-NHRBS13340
Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12039-NMRBS13340
Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12039-NYRBS13340
Человек Fibrinogen gamma chain Джин клон кДНК в вектор клонированияHG12039-URBS5130
Человек Fibrinogen gamma chain Джин ORF экспрессии кДНК клона плазмидыHG12039-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12039-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.