After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек FGFR1/CD331 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human FGFR1 Информация о продукте «Клон cDNA»
Размер кДНК:2196bp
Описание кДНК:Full length Clone DNA of Homo sapiens fibroblast growth factor receptor 1 with C terminal Myc tag.
Синоним гена:CEK, FLG, FLT2, KAL2, BFGFR, CD331, FGFBR, HBGFR, N-SAM, FLJ99988
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек FGFR1/CD331 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек FGFR1/CD331 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10616-ACGRBS16760
Человек FGFR1/CD331 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10616-ACRRBS16760
Человек FGFR1/CD331 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10616-CFRBS14710
Человек FGFR1/CD331 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10616-CHRBS14710
Человек FGFR1/CD331 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10616-CMRBS14710
Человек FGFR1/CD331 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10616-CYRBS14710
Человек FGFR1/CD331 transcript variant 4 Джин клон кДНК в вектор клонированияHG10616-MRBS5130
Человек FGFR1/CD331 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10616-NFRBS14710
Человек FGFR1/CD331 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10616-NHRBS14710
Человек FGFR1/CD331 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10616-NMRBS14710
Человек FGFR1/CD331 transcript variant 4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10616-NYRBS14710
Человек FGFR1/CD331 transcript variant 4 Джин ORF экспрессии кДНК клона плазмидыHG10616-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

FGFR1, also known as CD331, belongs to the fibroblast growth factor receptor subfamily where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. Fibroblast growth factors (FGFs) (FGF1 - 10 and 16 - 23) are mitogenic signaling molecules that have roles in angiogenesis, wound healing, cell migration, neural outgrowth and embryonic development. FGFs bind heparan sulfate glycosaminoglycans, which facilitates dimerization (activation) of FGF receptors. FGFR1 is a full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of FGFR1 interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds both acidic and basic fibroblast growth factors and is involved in limb induction. CD331 can be detected in astrocytoma, neuroblastoma and adrenal cortex cell lines. Some isoforms are detected in foreskin fibroblast cell lines, however isoform 17, isoform 18 and isoform 19 are not detected in these cells. Defects in FGFR1 are a cause of Pfeiffer syndrome ,idiopathic hypogonadotropic hypogonadism, Kallmann syndrome type 2, osteoglophonic dysplasia and trigonocephaly non-syndromic.

  • Schlessinger J, et al. (2000) Crystal structure of a ternary FGF-FGFR-heparin complex reveals a dual role for heparin in FGFR binding and dimerization. Mol Cell. 6(3):743-50.
  • Dodé C, et al. (2007) Novel FGFR1 sequence variants in Kallmann syndrome, and genetic evidence that the FGFR1c isoform is required in olfactory bulb and palate morphogenesis. Hum Mutat. 28(1): 97-8.
  • Kim HG, et al. (2005) Hypogonadotropic hypogonadism and cleft lip and palate caused by a balanced translocation producing haploinsufficiency for FGFR1. J Med Genet. 42(8):666-72.
  • Size / Price
    Каталог: HG10616-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.