Быстрый заказ

Человек FGF13 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек FGF13 Информация о продукте «Клон cDNA»
Размер кДНК:738bp
Описание кДНК:Full length Clone DNA of Homo sapiens fibroblast growth factor 13 with C terminal HA tag.
Синоним гена:FGF2, FHF2, FGF13
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
( We provide with FGF13 qPCR primers for gene expression analysis, HP101044 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек FGF13 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек FGF13 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11134-ACGRBS15400
Человек FGF13 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11134-ACRRBS15400
Человек FGF13 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11134-ANGRBS15400
Человек FGF13 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11134-ANRRBS15400
Человек FGF13 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11134-CFRBS13340
Человек FGF13 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11134-CHRBS13340
Человек FGF13 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11134-CMRBS13340
Человек FGF13 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11134-CYRBS13340
Человек FGF13 Джин клон кДНК в вектор клонированияHG11134-MRBS5130
Человек FGF13 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11134-M-FRBS13340
Человек FGF13 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11134-NFRBS13340
Человек FGF13 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11134-NHRBS13340
Человек FGF13 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11134-NMRBS13340
Человек FGF13 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11134-NYRBS13340
Человек FGF13 Джин ORF экспрессии кДНК клона плазмидыHG11134-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11134-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.