After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Человек FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human FGF10 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_004465.1
Размер кДНК:603bp
Описание кДНК:Full length Clone DNA of Homo sapiens fibroblast growth factor 10 with N terminal Flag tag.
Синоним гена:FGF10
Виды:Human
переносчик:pCMV3-SP-N-FLAG
Plasmid:pCMV3-Flag-FGF10
Участок рестрикции:KpnI + XbaI (6kb + 0.6kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human FGF10 Gene Plasmid Map
Human FGF10 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10573-ACGRBS15400
Человек FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10573-ACRRBS15400
Человек FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10573-CFRBS13340
Человек FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10573-CHRBS13340
Человек FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10573-CMRBS13340
Человек FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10573-CYRBS13340
Человек FGF10 / KGF2 Джин клон кДНК в вектор клонированияHG10573-MRBS5130
Человек FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10573-NFRBS13340
Человек FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10573-NHRBS13340
Человек FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10573-NMRBS13340
Человек FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10573-NYRBS13340
Человек FGF10 / KGF2 Джин ORF экспрессии кДНК клона плазмидыHG10573-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Fibroblast growth factor 10 (FGF10) is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF10 exhibits mitogenic activity for keratinizing epidermal cells, but essentially no activity for fibroblasts, which is similar to the biological activity of FGF7. FGF10 plays an important role in the regulation of embryonic development, cell proliferation and cell differentiation. FGF10 is required for normal branching morphogenesis. It may play a role in wound healing. Defects in FGF10 are the cause of autosomal dominant aplasia of lacrimal and salivary glands (ALSG). ALSG has variable expressivity, and affected individuals may have aplasia or hypoplasia of the lacrimal, parotid, submandibular and sublingual glands and absence of the lacrimal puncta. The disorder is characterized by irritable eyes, recurrent eye infections, epiphora (constant tearing) and xerostomia (dryness of the mouth), which increases the risk of dental erosion, dental caries, periodontal disease and oral infections.

Ссылки
  • Sekine K, et al. (1999) Fgf10 is essential for limb and lung formation. Nat Genet. 21(1): 138-41.
  • Ohuchi H, et al. (2000) FGF10 acts as a major ligand for FGF receptor 2 IIIb in mouse multi-organ development. Biochem Biophys Res Commun. 277(3): 643-9.
  • Bellusci S, et al. (1997) Fibroblast growth factor 10 (FGF10) and branching morphogenesis in the embryonic mouse lung. Development. 124(23): 4867-78.
  • Size / Price
    Каталог: HG10573-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human FGF10 natural ORF mammalian expression plasmid, N-Flag tag
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».