FEM1B cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

FEM1B cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1884 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations 1479 T/C and 1686 C/A not causing the amino acid variation.
Description
Full length Clone DNA of Human fem-1 homolog b (C. elegans).
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 1.88kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FEM1B cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FEM1B cDNA ORF Clone, Human, untagged: Validated Images

FEM1B cDNA ORF Clone, Human, untagged: Alternative Names

F1A-ALPHA cDNA ORF Clone, Human; F1AA cDNA ORF Clone, Human; FEM1-beta cDNA ORF Clone, Human

FEM1B Background Information

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait