After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human FEM1B Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_015322.3
Размер кДНК:1884bp
Описание кДНК:Full length Clone DNA of Homo sapiens fem-1 homolog b (C. elegans).
Синоним гена:FIAA, DKFZp451E0710, FEM1B
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-FEM1B
Участок рестрикции:KpnI + XbaI (6.1kb + 1.88kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations 1479 T/C and 1686 C/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human FEM1B Gene Plasmid Map
Human FEM1B Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11180-ACGRBS16760
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11180-ACRRBS16760
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11180-ANGRBS16760
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11180-ANRRBS16760
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11180-CFRBS14710
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11180-CHRBS14710
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11180-CMRBS14710
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11180-CYRBS14710
Человек FEM1B Джин клон кДНК в вектор клонированияHG11180-MRBS5130
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11180-NFRBS14710
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11180-NHRBS14710
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11180-NMRBS14710
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11180-NYRBS14710
Человек FEM1B Джин ORF экспрессии кДНК клона плазмидыHG11180-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11180-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
  • Human FEM1B Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».