Быстрый заказ

Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human FEM1B Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_015322.3
Размер кДНК:1884bp
Описание кДНК:Full length Clone DNA of Homo sapiens fem-1 homolog b (C. elegans) with N terminal HA tag.
Синоним гена:FIAA, DKFZp451E0710, FEM1B
Виды:Human
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11180-ACGRBS16760
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11180-ACRRBS16760
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11180-ANGRBS16760
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11180-ANRRBS16760
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11180-CFRBS14710
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11180-CHRBS14710
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11180-CMRBS14710
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11180-CYRBS14710
Человек FEM1B Джин клон кДНК в вектор клонированияHG11180-MRBS5130
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11180-NFRBS14710
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11180-NHRBS14710
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11180-NMRBS14710
Человек FEM1B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11180-NYRBS14710
Человек FEM1B Джин ORF экспрессии кДНК клона плазмидыHG11180-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11180-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».