Быстрый заказ

Человек Emi1 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек FBXO5 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC018905
    Размер кДНК:1344bp
    Описание кДНК:Full length Clone DNA of Homo sapiens F-box protein 5.
    Синоним гена:EMI1, FBX5, Fbxo31, FBXO5
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FBXO5 qPCR primers for gene expression analysis, HP102002 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек Emi1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек Emi1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13294-ACGRBS15400
    Человек Emi1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13294-ACRRBS15400
    Человек Emi1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13294-ANGRBS15400
    Человек Emi1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13294-ANRRBS15400
    Человек Emi1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13294-CFRBS13340
    Человек Emi1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13294-CHRBS13340
    Человек Emi1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13294-CMRBS13340
    Человек Emi1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13294-CYRBS13340
    Человек Emi1 Джин клон кДНК в вектор клонированияHG13294-GRBS5130
    Человек Emi1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13294-NFRBS13340
    Человек Emi1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13294-NHRBS13340
    Человек Emi1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13294-NMRBS13340
    Человек Emi1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13294-NYRBS13340
    Человек Emi1 Джин ORF экспрессии кДНК клона плазмидыHG13294-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG13294-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».