Быстрый заказ

Человек Fub1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек FAU Информация о продукте «Клон cDNA»
    Размер кДНК:402bp
    Описание кДНК:Full length Clone DNA of Homo sapiens Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed with C terminal His tag.
    Синоним гена:S30, FAU1, Fub1, Fubi, asr1, RPS30, MNSFbeta
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with FAU qPCR primers for gene expression analysis, HP104348 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек Fub1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек Fub1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15756-ACGRBS15400
    Человек Fub1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15756-ACRRBS15400
    Человек Fub1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15756-ANGRBS15400
    Человек Fub1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15756-ANRRBS15400
    Человек Fub1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15756-CFRBS13340
    Человек Fub1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15756-CHRBS13340
    Человек Fub1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15756-CMRBS13340
    Человек Fub1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15756-CYRBS13340
    Человек Fub1 Джин клон кДНК в вектор клонированияHG15756-GRBS5130
    Человек Fub1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15756-NFRBS13340
    Человек Fub1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15756-NHRBS13340
    Человек Fub1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15756-NMRBS13340
    Человек Fub1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15756-NYRBS13340
    Человек Fub1 Джин ORF экспрессии кДНК клона плазмидыHG15756-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG15756-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.