Быстрый заказ

Человек FASTKD3 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human FASTKD3 Информация о продукте «Клон cDNA»
Размер кДНК:1989bp
Описание кДНК:Full length Clone DNA of Homo sapiens FAST kinase domains 3 with C terminal HA tag.
Синоним гена:FASTKD3
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек FASTKD3 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек FASTKD3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15750-ACGRBS16764
Человек FASTKD3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15750-ACRRBS16760
Человек FASTKD3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15750-ANGRBS16760
Человек FASTKD3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15750-ANRRBS16760
Человек FASTKD3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15750-CFRBS14711
Человек FASTKD3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15750-CHRBS14711
Человек FASTKD3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15750-CMRBS14711
Человек FASTKD3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15750-CYRBS14711
Человек FASTKD3 Джин клон кДНК в вектор клонированияHG15750-GRBS5132
Человек FASTKD3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15750-NFRBS14711
Человек FASTKD3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15750-NHRBS14710
Человек FASTKD3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15750-NMRBS14711
Человек FASTKD3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15750-NYRBS14711
Человек FASTKD3 Джин ORF экспрессии кДНК клона плазмидыHG15750-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15750-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.