After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек FAN1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human FAN1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC047882
Размер кДНК:1602bp
Описание кДНК:Full length Clone DNA of Homo sapiens FANCD2/FANCI-associated nuclease 1 DNA.
Синоним гена:KMIN, MTMR15, KIAA1018
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек FAN1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек FAN1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15223-ACGRBS16760
Человек FAN1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15223-ACRRBS16760
Человек FAN1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15223-ANGRBS16760
Человек FAN1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15223-ANRRBS16760
Человек FAN1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15223-CFRBS14710
Человек FAN1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15223-CHRBS14710
Человек FAN1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15223-CMRBS14710
Человек FAN1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15223-CYRBS14710
Человек FAN1 Джин клон кДНК в вектор клонированияHG15223-GRBS5130
Человек FAN1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15223-NFRBS14710
Человек FAN1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15223-NHRBS14710
Человек FAN1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15223-NMRBS14710
Человек FAN1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15223-NYRBS14710
Человек FAN1 Джин ORF экспрессии кДНК клона плазмидыHG15223-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15223-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».