Быстрый заказ

Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек FAM19A5 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_015381.5
    Размер кДНК:378bp
    Описание кДНК:Full length Clone DNA of Homo sapiens family with sequence similarity 19 (chemokine (C-C motif)-like), member A5 with N terminal His tag.
    Синоним гена:TAFA5, TAFA-5, UNQ5208, QLLK5208, FAM19A5
    Виды:Human
    переносчик:pCMV3-SP-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FAM19A5 qPCR primers for gene expression analysis, HP101251 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11369-ACGRBS15400
    Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11369-ACRRBS15400
    Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11369-CFRBS13340
    Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11369-CHRBS13340
    Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11369-CMRBS13340
    Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11369-CYRBS13340
    Человек FAM19A5 Джин клон кДНК в вектор клонированияHG11369-MRBS5130
    Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11369-M-FRBS13340
    Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11369-NFRBS13340
    Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11369-NHRBS13340
    Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11369-NMRBS13340
    Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11369-NYRBS13340
    Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмидыHG11369-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG11369-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».