After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human FAM19A5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_015381.5
Размер кДНК:378bp
Описание кДНК:Full length Clone DNA of Homo sapiens family with sequence similarity 19 (chemokine (C-C motif)-like), member A5 with N terminal His tag.
Синоним гена:TAFA5, TAFA-5, UNQ5208, QLLK5208, FAM19A5
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11369-ACGRBS15400
Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11369-ACRRBS15400
Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11369-CFRBS13340
Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11369-CHRBS13340
Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11369-CMRBS13340
Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11369-CYRBS13340
Человек FAM19A5 Джин клон кДНК в вектор клонированияHG11369-MRBS5130
Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11369-M-FRBS13340
Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11369-NFRBS13340
Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11369-NHRBS13340
Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11369-NMRBS13340
Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11369-NYRBS13340
Человек FAM19A5 Джин ORF экспрессии кДНК клона плазмидыHG11369-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».