After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек FAM19A1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human FAM19A1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_213609.2
Размер кДНК:402bp
Описание кДНК:Full length Clone DNA of Homo sapiens family with sequence similarity 19 (chemokine (C-C motif)-like), member A1.
Синоним гена:TAFA1, TAFA-1, FAM19A1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-FAM19A1
Участок рестрикции:KpnI + XbaI (6.1kb + 0.4kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human FAM19A1 Gene Plasmid Map
Human FAM19A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек FAM19A1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек FAM19A1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11182-ACGRBS15400
Человек FAM19A1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11182-ACRRBS15400
Человек FAM19A1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11182-CFRBS13340
Человек FAM19A1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11182-CHRBS13340
Человек FAM19A1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11182-CMRBS13340
Человек FAM19A1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11182-CYRBS13340
Человек FAM19A1 Джин клон кДНК в вектор клонированияHG11182-MRBS5130
Человек FAM19A1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11182-M-FRBS13340
Человек FAM19A1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11182-NFRBS13340
Человек FAM19A1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11182-NHRBS13340
Человек FAM19A1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11182-NMRBS13340
Человек FAM19A1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11182-NYRBS13340
Человек FAM19A1 Джин ORF экспрессии кДНК клона плазмидыHG11182-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».