Быстрый заказ

Человек NIP30 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек FAM192A Информация о продукте «Клон cDNA»
    Размер кДНК:765bp
    Описание кДНК:Full length Clone DNA of Homo sapiens family with sequence similarity 192, member A with C terminal HA tag.
    Синоним гена:CDA10, NIP30, CDA018, C16orf94
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    ( We provide with FAM192A qPCR primers for gene expression analysis, HP105120 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек NIP30 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Человек NIP30 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16370-ACGRBS15400
    Человек NIP30 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16370-ACRRBS15400
    Человек NIP30 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16370-ANGRBS15400
    Человек NIP30 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16370-ANRRBS15400
    Человек NIP30 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16370-CFRBS13340
    Человек NIP30 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16370-CHRBS13340
    Человек NIP30 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16370-CMRBS13340
    Человек NIP30 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16370-CYRBS13340
    Человек NIP30 Джин клон кДНК в вектор клонированияHG16370-GRBS5130
    Человек NIP30 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16370-NFRBS13340
    Человек NIP30 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16370-NHRBS13340
    Человек NIP30 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16370-NMRBS13340
    Человек NIP30 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16370-NYRBS13340
    Человек NIP30 Джин ORF экспрессии кДНК клона плазмидыHG16370-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG16370-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.