Быстрый заказ

Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек FAM108A1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC000158
    Размер кДНК:711bp
    Описание кДНК:Full length Clone DNA of Homo sapiens family with sequence similarity 108, member A1.
    Синоним гена:C19orf27, FAM108A1
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FAM108A1 qPCR primers for gene expression analysis, HP101994 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13286-ACGRBS15400
    Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13286-ACRRBS15400
    Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13286-CFRBS13340
    Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13286-CHRBS13340
    Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13286-CMRBS13340
    Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13286-CYRBS13340
    Человек FAM108A1 Джин клон кДНК в вектор клонированияHG13286-GRBS5130
    Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13286-NFRBS13340
    Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13286-NHRBS13340
    Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13286-NMRBS13340
    Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13286-NYRBS13340
    Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмидыHG13286-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG13286-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».