After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human FAM108A1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC000158
Размер кДНК:711bp
Описание кДНК:Full length Clone DNA of Homo sapiens family with sequence similarity 108, member A1.
Синоним гена:C19orf27, FAM108A1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13286-ACGRBS15396
Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13286-ACRRBS15396
Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13286-CFRBS13343
Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13286-CHRBS13343
Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13286-CMRBS13343
Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13286-CYRBS13343
Человек FAM108A1 Джин клон кДНК в вектор клонированияHG13286-GRBS5132
Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13286-NFRBS13343
Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13286-NHRBS13343
Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13286-NMRBS13343
Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13286-NYRBS13343
Человек FAM108A1 Джин ORF экспрессии кДНК клона плазмидыHG13286-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13286-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».