After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек FAHD1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human FAHD1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC063017
Размер кДНК:681bp
Описание кДНК:Full length Clone DNA of Homo sapiens fumarylacetoacetate hydrolase domain containing 1 DNA.
Синоним гена:YISKL, C16orf36
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек FAHD1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек FAHD1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15239-ACGRBS15400
Человек FAHD1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15239-ACRRBS15400
Человек FAHD1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15239-ANGRBS15400
Человек FAHD1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15239-ANRRBS15400
Человек FAHD1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15239-CFRBS13340
Человек FAHD1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15239-CHRBS13340
Человек FAHD1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15239-CMRBS13340
Человек FAHD1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15239-CYRBS13340
Человек FAHD1 Джин клон кДНК в вектор клонированияHG15239-GRBS5130
Человек FAHD1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15239-NFRBS13340
Человек FAHD1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15239-NHRBS13340
Человек FAHD1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15239-NMRBS13340
Человек FAHD1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15239-NYRBS13340
Человек FAHD1 Джин ORF экспрессии кДНК клона плазмидыHG15239-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15239-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».