Быстрый заказ

Человек FABP4 /A-FABP Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек FABP4 Информация о продукте «Клон cDNA»
Размер кДНК:399bp
Описание кДНК:Full length Clone DNA of Homo sapiens fatty acid binding protein 4, adipocyte with N terminal HA tag.
Синоним гена:aP2, A-FABP, FABP4
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
( We provide with FABP4 qPCR primers for gene expression analysis, HP101637 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек FABP4 /A-FABP Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек FABP4 /A-FABP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12109-ACGRBS15400
Человек FABP4 /A-FABP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12109-ACRRBS15400
Человек FABP4 /A-FABP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12109-ANGRBS15400
Человек FABP4 /A-FABP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12109-ANRRBS15400
Человек FABP4 /A-FABP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12109-CFRBS13340
Человек FABP4 /A-FABP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12109-CHRBS13340
Человек FABP4 /A-FABP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12109-CMRBS13340
Человек FABP4 /A-FABP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12109-CYRBS13340
Человек FABP4 /A-FABP Джин клон кДНК в вектор клонированияHG12109-MRBS5130
Человек FABP4 /A-FABP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12109-NFRBS13340
Человек FABP4 /A-FABP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12109-NHRBS13340
Человек FABP4 /A-FABP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12109-NMRBS13340
Человек FABP4 /A-FABP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12109-NYRBS13340
Человек FABP4 /A-FABP Джин ORF экспрессии кДНК клона плазмидыHG12109-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Fatty acid-binding protein, adipocyte, also known as Adipocyte-type fatty acid-binding protein, Fatty acid-binding protein 4, Adipocyte lipid-binding protein, and FABP4, is a cytoplasm protein which belongs to the calycin superfamily and Fatty-acid binding protein (FABP) family. In familial combined hyperlipidemia (FCHL), FABP4 correlated to body mass index (BMI), waist circumference and homeostasis model assessment (HOMA) index.FABP4 levels were associated with triglyceride-rich lipoproteins. In humans serum FABP4 levels correlate significantly with features of PCOS. It appears to be a determinant of atherogenic dyslipidemia. FABP4 pathway mediates the sebaceous gland hyperplasia in keratinocyte-specific Pten-null mice. FABP4 concentration significantly increased with an increasing of MS features and was strongly correlated with body-mass index, triglycerides, HDL-cholesterol concentrations and blood pressure. Patients in the highest quartile of FABP4 presented a six-fold increased odds ratio for MS and a three-fold increased odds for LD, adjusted by age, sex, body-mass index and the antiretroviral therapy. FABP4 is a strong plasma marker of metabolic disturbances in HIV-infected patients, and therefore, could serve to guide therapeutic intervention in this group of patients.

  • van Dongen,M.J. et al., 2002, J Am Chem Soc. 124 (40): 11874-80.
  • Coll, B. et al., 2008, Atherosclerosis  199 (1):147-53.
  • Hoashi,S. et al., 2008, BMC Genet. 9 :84.
  • Cai,H. et al., 2010, Bioorg Med Chem Lett  20 (12):3675-9.
  • Size / Price
    Каталог: HG12109-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.