Быстрый заказ

Человек Coagulation Factor VII transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек F7 Информация о продукте «Клон cDNA»
    Размер кДНК:1335bp
    Описание кДНК:Full length Clone DNA of Homo sapiens coagulation factor VII (serum prothrombin conversion accelerator) transcript variant 1 with C terminal Myc tag.
    Синоним гена:SPCA
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    ( We provide with F7 qPCR primers for gene expression analysis, HP101379 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек Coagulation Factor VII transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
    Человек Coagulation Factor VII transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14137-ACGRBS15400
    Человек Coagulation Factor VII transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14137-ACRRBS15400
    Человек Coagulation Factor VII transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14137-CFRBS13340
    Человек Coagulation Factor VII transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14137-CHRBS13340
    Человек Coagulation Factor VII transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14137-CMRBS13340
    Человек Coagulation Factor VII transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14137-CYRBS13340
    Человек Coagulation Factor VII transcript variant 1 Джин клон кДНК в вектор клонированияHG14137-GRBS5130
    Человек Coagulation Factor VII transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14137-NFRBS13340
    Человек Coagulation Factor VII transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14137-NHRBS13340
    Человек Coagulation Factor VII transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14137-NMRBS13340
    Человек Coagulation Factor VII transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14137-NYRBS13340
    Человек Coagulation Factor VII transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG14137-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    Coagulation factor VII, also known as Serum prothrombin conversion accelerator, Factor VII, F7 and FVII, is a member of the peptidase S1 family. Factor VII is one of the central proteins in the coagulation cascade. It is an enzyme of the serine protease class, and Factor VII (FVII) deficiency is the most frequent among rare congenital bleeding disorders. Factor VII contains two EGF-like domains, one Gla (gamma-carboxy-glutamate) domain and one peptidase S1 domain. The main role of factor VII is to initiate the process of coagulation in conjunction with tissue factor (TF). Tissue factor is found on the outside of blood vessels, normally not exposed to the blood stream. The action of the Factor VII is impeded by tissue factor pathway inhibitor (TFPI), which is released almost immediately after initiation of coagulation. Factor VII is vitamin K dependent and is produced in the liver. Upon vessel injury, tissue factor is exposed to the blood and circulating Factor VII. Once bound to TF, FVII is activated to FVIIa by different proteases, among which are thrombin (factor IIa), factor Xa, IXa, XIIa, and the FVIIa-TF complex itself. Recombinant activated factor VII (rFVIIa) is a haemostatic agent, which was originally developed for the treatment of haemophilia patients with inhibitors against factor FVIII or FIX. FVIIa binds specifically to endothelial protein C receptor (EPCR), a known cellular receptor for protein C and activated protein C, on the endothelium. rFVIIa is a novel hemostatic agent, originally developed for the treatment of hemorrhage in hemophiliacs with inhibitors, which has been successfully used recently in an increasing number of nonhemophilic bleeding conditions.

  • Franchini M, et al. (2007) Potential role of recombinant activated factor VII for the treatment of severe bleeding associated with disseminated intravascular coagulation: a systematic review. Blood Coagul Fibrinolysis. 18(7): 589-93.
  • Lapecorella M, et al. (2008) Factor VII deficiency: defining the clinical picture and optimizing therapeutic options. Haemophilia. 14(6): 1170-5.
  • Grottke O, et al. (2010) Activated recombinant factor VII (rFVIIa). Best Pract Res Clin Anaesthesiol. 24(1): 95-106.
  • Size / Price
    Каталог: HG14137-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.