After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Thrombin Receptor Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human F2R Информация о продукте «Клон cDNA»
Размер кДНК:1278bp
Описание кДНК:Full length Clone DNA of Homo sapiens coagulation factor II (thrombin) receptor with C terminal Myc tag.
Синоним гена:RCN, RCAL, PIG20, RCN1
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек Thrombin Receptor Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек Thrombin Receptor Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13535-ACGRBS15396
Человек Thrombin Receptor Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13535-ACRRBS15396
Человек Thrombin Receptor Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13535-CFRBS13343
Человек Thrombin Receptor Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13535-CHRBS13343
Человек Thrombin Receptor Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13535-CMRBS13343
Человек Thrombin Receptor Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13535-CYRBS13343
Человек Thrombin Receptor Джин клон кДНК в вектор клонированияHG13535-GRBS5132
Человек Thrombin Receptor Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13535-NFRBS13343
Человек Thrombin Receptor Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13535-NHRBS13343
Человек Thrombin Receptor Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13535-NMRBS13343
Человек Thrombin Receptor Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13535-NYRBS13343
Человек Thrombin Receptor Джин ORF экспрессии кДНК клона плазмидыHG13535-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13535-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.