Быстрый заказ

Человек EphB2/Eph Receptor B2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек EPHB2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_004442.6
    Размер кДНК:2964bp
    Описание кДНК:Full length Clone DNA of Homo sapiens EPH receptor B2 with N terminal His tag.
    Синоним гена:DRT, ERK, CAPB, Hek5, PCBC, EPHT3, Tyro5, MGC87492, EPHB2
    Виды:Human
    переносчик:pCMV3-SP-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with EphB2 qPCR primers for gene expression analysis, HP100901 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек EphB2/Eph Receptor B2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек EphB2/Eph Receptor B2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10762-ACGRBS22240
    Человек EphB2/Eph Receptor B2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10762-ACRRBS22240
    Человек EphB2/Eph Receptor B2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10762-CFRBS20190
    Человек EphB2/Eph Receptor B2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10762-CHRBS20190
    Человек EphB2/Eph Receptor B2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10762-CMRBS20190
    Человек EphB2/Eph Receptor B2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10762-CYRBS20190
    Человек EphB2/Eph Receptor B2 Джин клон кДНК в вектор клонированияHG10762-MRBS5130
    Человек EphB2/Eph Receptor B2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10762-NFRBS20190
    Человек EphB2/Eph Receptor B2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10762-NHRBS20190
    Человек EphB2/Eph Receptor B2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10762-NMRBS20190
    Человек EphB2/Eph Receptor B2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10762-NYRBS20190
    Человек EphB2/Eph Receptor B2 Джин ORF экспрессии кДНК клона плазмидыHG10762-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Ephrin type-B receptor 2, also known as EphB2, belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family which 16 known receptors (14 found in mammals) are involved: EPHA1, EPHA2, EPHA3, EPHA4, EPHA5, EPHA6, EPHA7, EPHA8, EPHA9, EPHA10, EPHB1, EPHB2, EPHB3, EPHB4, EPHB5, EPHB6. EphB2 receptor tyrosine kinase phosphorylates syndecan-2 and that this phosphorylation event is crucial for syndecan-2 clustering and spine formation. The Eph family of receptor tyrosine kinases (comprising EphA and EphB receptors) has been implicated in synapse formation and the regulation of synaptic function and plasticity6. Ephrin receptors are components of cell signalling pathways involved in animal growth and development, forming the largest sub-family of receptor tyrosine kinases (RTKs). Ligand-mediated activation of Ephs induce various important downstream effects and Eph receptors have been studied for their potential roles in the development of cancer. EphB receptor tyrosine kinases are enriched at synapses, suggesting that these receptors play a role in synapse formation or function. We find that EphrinB binding to EphB induces a direct interaction of EphB with NMDA-type glutamate receptors. This interaction occurs at the cell surface and is mediated by the extracellular regions of the two receptors, but does not require the kinase activity of EphB.

    Ссылки
  • Zisch AH, et al. (1998) Complex formation between EphB2 and Src requires phosphorylation of tyrosine 611 in the EphB2 juxtamembrane region. Oncogene. 16 (20): 2657-70.
  • Yu HH, et al. (2001) Multiple signaling interactions of Abl and Arg kinases with the EphB2 receptor. Oncogene. 20 (30): 3995-4006.
  • Zisch AH, et al. (2000) Replacing two conserved tyrosines of the EphB2 receptor with glutamic acid prevents binding of SH2 domains without abrogating kinase activity and biological responses. Oncogene. 19 (2): 177-87.
  • Size / Price
    Каталог: HG10762-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».