EXTL3 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Price:
Size:
Number:

EXTL3 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2760 bp
Description
Full length Clone DNA of Human exostoses (multiple)-like 3 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

EXTL3 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

BOTV cDNA ORF Clone, Human; EXTL1L cDNA ORF Clone, Human; EXTR1 cDNA ORF Clone, Human; REGR cDNA ORF Clone, Human; RPR cDNA ORF Clone, Human

EXTL3 Background Information

Full Name
exostosin-like glycosyltransferase 3
Add to Cart Successfully Add to Cart Failed