ESD cDNA ORF Clone, Human, N-His tag

Price:
Size:
Number:

ESD cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
849 bp
Description
Full length Clone DNA of Human esterase D with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ESD cDNA ORF Clone, Human, N-His tag: Alternative Names

FGH cDNA ORF Clone, Human

ESD Background Information

Esterase D, also known as ESD, is a serine hydrolase that belongs to the esterase D family. Esterase D is active toward numerous substrates including O-acetylated sialic acids, and it may be involved in the recycling of sialic acids. Esterase D gene is used as a genetic marker and a diagnostic tool for retinoblastoma, Wilson's disease and other hereditary or acquired diseases controlled by genes located at the 13 chromosome 13q14 region.
Full Name
esterase D
References
  • Lee EY, et al. (1986) Molecular cloning of the human esterase D gene, a genetic marker of retinoblastoma. Proc Natl Acad Sci. 83(17):6337-41.
  • Lee EY, et al. (1988) Human esterase D gene: complete cDNA sequence, genomic structure, and application in the genetic diagnosis of human retinoblastoma. Hum Genet. 79(2): 137-41.
  • Saito S, et al. (2003) Catalog of 680 variations among eight cytochrome p450 ( CYP) genes, nine esterase genes, and two other genes in the Japanese population. J Hum Genet. 48(5): 249-70.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait