Быстрый заказ

Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ESD Информация о продукте «Клон cDNA»
Размер кДНК:849bp
Описание кДНК:Full length Clone DNA of Homo sapiens esterase D with N terminal His tag.
Синоним гена:RP11-147L20.1, FGH, FLJ11763, ESD
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14252-ACGRBS15400
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14252-ACRRBS15400
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14252-ANGRBS15400
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14252-ANRRBS15400
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14252-CFRBS13340
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14252-CHRBS13340
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14252-CMRBS13340
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14252-CYRBS13340
Человек Esterase D/ESD Джин клон кДНК в вектор клонированияHG14252-GRBS5130
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14252-NFRBS13340
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14252-NHRBS13340
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14252-NMRBS13340
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14252-NYRBS13340
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмидыHG14252-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Esterase D, also known as ESD, is a serine hydrolase that belongs to the esterase D family. Esterase D is active toward numerous substrates including O-acetylated sialic acids, and it may be involved in the recycling of sialic acids. Esterase D gene is used as a genetic marker and a diagnostic tool for retinoblastoma, Wilson's disease and other hereditary or acquired diseases controlled by genes located at the 13 chromosome 13q14 region.

  • Lee EY, et al. (1986) Molecular cloning of the human esterase D gene, a genetic marker of retinoblastoma. Proc Natl Acad Sci. 83(17):6337-41.
  • Lee EY, et al. (1988) Human esterase D gene: complete cDNA sequence, genomic structure, and application in the genetic diagnosis of human retinoblastoma. Hum Genet. 79(2): 137-41.
  • Saito S, et al. (2003) Catalog of 680 variations among eight cytochrome p450 ( CYP) genes, nine esterase genes, and two other genes in the Japanese population. J Hum Genet. 48(5): 249-70.
  • Size / Price
    Каталог: HG14252-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.