After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ESD Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC001169
Размер кДНК:849bp
Описание кДНК:Full length Clone DNA of Homo sapiens esterase D with N terminal His tag.
Синоним гена:RP11-147L20.1, FGH, FLJ11763, ESD
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14252-ACGRBS15400
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14252-ACRRBS15400
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14252-ANGRBS15400
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14252-ANRRBS15400
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14252-CFRBS13340
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14252-CHRBS13340
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14252-CMRBS13340
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14252-CYRBS13340
Человек Esterase D/ESD Джин клон кДНК в вектор клонированияHG14252-GRBS5130
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14252-NFRBS13340
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14252-NHRBS13340
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14252-NMRBS13340
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14252-NYRBS13340
Человек Esterase D/ESD Джин ORF экспрессии кДНК клона плазмидыHG14252-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Esterase D, also known as ESD, is a serine hydrolase that belongs to the esterase D family. Esterase D is active toward numerous substrates including O-acetylated sialic acids, and it may be involved in the recycling of sialic acids. Esterase D gene is used as a genetic marker and a diagnostic tool for retinoblastoma, Wilson's disease and other hereditary or acquired diseases controlled by genes located at the 13 chromosome 13q14 region.

Ссылки
  • Lee EY, et al. (1986) Molecular cloning of the human esterase D gene, a genetic marker of retinoblastoma. Proc Natl Acad Sci. 83(17):6337-41.
  • Lee EY, et al. (1988) Human esterase D gene: complete cDNA sequence, genomic structure, and application in the genetic diagnosis of human retinoblastoma. Hum Genet. 79(2): 137-41.
  • Saito S, et al. (2003) Catalog of 680 variations among eight cytochrome p450 ( CYP) genes, nine esterase genes, and two other genes in the Japanese population. J Hum Genet. 48(5): 249-70.
  • Size / Price
    Каталог: HG14252-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».