Быстрый заказ

Человек HERV-FRD Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ERVFRD-1 Информация о продукте «Клон cDNA»
Размер кДНК:1617bp
Описание кДНК:Full length Clone DNA of Homo sapiens endogenous retrovirus group FRD, member 1 with N terminal Myc tag.
Синоним гена:envFRD, UNQ6191, ERVFRDE1, GLLL6191, HERV-FRD, HERV-W/FRD
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек HERV-FRD Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек HERV-FRD Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15482-ACGRBS16760
Человек HERV-FRD Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15482-ACRRBS16760
Человек HERV-FRD Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15482-CFRBS14710
Человек HERV-FRD Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15482-CHRBS14710
Человек HERV-FRD Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15482-CMRBS14710
Человек HERV-FRD Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15482-CYRBS14710
Человек HERV-FRD Джин клон кДНК в вектор клонированияHG15482-GRBS5130
Человек HERV-FRD Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15482-NFRBS14710
Человек HERV-FRD Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15482-NHRBS14710
Человек HERV-FRD Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15482-NMRBS14710
Человек HERV-FRD Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15482-NYRBS14710
Человек HERV-FRD Джин ORF экспрессии кДНК клона плазмидыHG15482-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15482-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.