Быстрый заказ

Text Size:AAA

Человек ERCC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ERCC1 Информация о продукте «Клон cDNA»
Размер кДНК:894bp
Описание кДНК:Full length Clone DNA of Homo sapiens excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence) with C terminal HA tag.
Синоним гена:ERCC1
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек ERCC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек ERCC1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12067-ACGRBS15396
Человек ERCC1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12067-ACRRBS15396
Человек ERCC1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12067-ANGRBS15396
Человек ERCC1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12067-ANRRBS15396
Человек ERCC1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12067-CFRBS13343
Человек ERCC1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12067-CHRBS13343
Человек ERCC1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12067-CMRBS13343
Человек ERCC1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12067-CMRBS13343
Человек ERCC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12067-CYRBS13343
Человек ERCC1 Джин клон кДНК в вектор клонированияHG12067-GRBS5132
Человек ERCC1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12067-NFRBS13343
Человек ERCC1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12067-NHRBS13343
Человек ERCC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12067-NMRBS13343
Человек ERCC1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12067-NYRBS13343
Человек ERCC1 Джин ORF экспрессии кДНК клона плазмидыHG12067-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12067-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.