After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек GTP binding Белок era homolog Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human ERAL1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC019094
Размер кДНК:1314bp
Описание кДНК:Full length Clone DNA of Homo sapiens Era G-protein-like 1 (E. coli).
Синоним гена:ERA, ERAL1A, H-ERA, HERA-A, HERA-B, ERAL1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек GTP binding Белок era homolog Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек GTP binding Белок era homolog Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14271-ACGRBS15400
Человек GTP binding Белок era homolog Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14271-ACRRBS15400
Человек GTP binding Белок era homolog Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14271-ANGRBS15400
Человек GTP binding Белок era homolog Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14271-ANRRBS15400
Человек GTP binding Белок era homolog Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14271-CFRBS13340
Человек GTP binding Белок era homolog Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14271-CHRBS13340
Человек GTP binding Белок era homolog Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14271-CMRBS13340
Человек GTP binding Белок era homolog Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14271-CYRBS13340
Человек GTP binding Белок era homolog Джин клон кДНК в вектор клонированияHG14271-GRBS5130
Человек GTP binding Белок era homolog Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14271-NFRBS13340
Человек GTP binding Белок era homolog Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14271-NHRBS13340
Человек GTP binding Белок era homolog Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14271-NMRBS13340
Человек GTP binding Белок era homolog Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14271-NYRBS13340
Человек GTP binding Белок era homolog Джин ORF экспрессии кДНК клона плазмидыHG14271-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14271-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».