After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек C9ORF11 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human EQTN Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC014307
Размер кДНК:384bp
Описание кДНК:Full length Clone DNA of Homo sapiens chromosome 9 open reading frame 11.
Синоним гена:AFAF, equatorin, C9orf11
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек C9ORF11 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек C9ORF11 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13292-ACGRBS15400
Человек C9ORF11 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13292-ACRRBS15400
Человек C9ORF11 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13292-ANGRBS15400
Человек C9ORF11 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13292-ANRRBS15400
Человек C9ORF11 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13292-CFRBS13340
Человек C9ORF11 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13292-CHRBS13340
Человек C9ORF11 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13292-CMRBS13340
Человек C9ORF11 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13292-CYRBS13340
Человек C9ORF11 Джин клон кДНК в вектор клонированияHG13292-GRBS5130
Человек C9ORF11 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13292-NFRBS13340
Человек C9ORF11 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13292-NHRBS13340
Человек C9ORF11 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13292-NMRBS13340
Человек C9ORF11 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13292-NYRBS13340
Человек C9ORF11 Джин ORF экспрессии кДНК клона плазмидыHG13292-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13292-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».