EPS8 cDNA ORF Clone, Human, N-HA tag

Cat: HG11153-NY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All EPS8 Reagents

CRO Services

Product recommended


All EPS8 Reagents

EPS8 cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
2469 bp
Description
Full length Clone DNA of Human epidermal growth factor receptor pathway substrate 8 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EPS8 cDNA ORF Clone, Human, N-HA tag Alternative Names

DFNB102 cDNA ORF Clone, Human

EPS8 Background Information

Full Name
epidermal growth factor receptor pathway substrate 8

EPS8 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EPS8 cDNA ORF Clone in Cloning Vector, Mouse MG52484-U
EPS8 cDNA ORF Clone, Mouse, untagged MG52484-UT
EPS8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52484-ACGLN
EPS8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52484-ACG
EPS8 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52484-ANG
EPS8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52484-ACR
EPS8 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52484-ANR
EPS8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52484-CF
EPS8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52484-NF
EPS8 cDNA ORF Clone, Mouse, C-His tag MG52484-CH
EPS8 cDNA ORF Clone, Mouse, N-His tag MG52484-NH
EPS8 cDNA ORF Clone, Mouse, C-HA tag MG52484-CY
EPS8 cDNA ORF Clone, Mouse, N-HA tag MG52484-NY
EPS8 cDNA ORF Clone, Mouse, C-Myc tag MG52484-CM
EPS8 cDNA ORF Clone, Mouse, N-Myc tag MG52484-NM
EPS8 qPCR Primer Pairs, Mouse MP202357

EPS8 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EPS8 cDNA ORF Clone in Cloning Vector, Human HG11153-G
EPS8 cDNA ORF Clone, Human, untagged HG11153-UT
EPS8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11153-ACGLN
EPS8 cDNA ORF Clone, Human, C-GFPSpark® tag HG11153-ACG
EPS8 cDNA ORF Clone, Human, N-GFPSpark® tag HG11153-ANG
EPS8 cDNA ORF Clone, Human, C-OFPSpark® tag HG11153-ACR
EPS8 cDNA ORF Clone, Human, N-OFPSpark® tag HG11153-ANR
EPS8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11153-CF
EPS8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11153-NF
EPS8 cDNA ORF Clone, Human, C-His tag HG11153-CH
EPS8 cDNA ORF Clone, Human, N-His tag HG11153-NH
EPS8 cDNA ORF Clone, Human, C-HA tag HG11153-CY
EPS8 cDNA ORF Clone, Human, C-Myc tag HG11153-CM
EPS8 cDNA ORF Clone, Human, N-Myc tag HG11153-NM
EPS8 qPCR Primer Pairs, Human HP101062
info info
添加购物车成功! 添加购物车失败!