EPOR cDNA ORF Clone, Human, C-DDK (Flag®) tag

1/2
Price:
Size:
Number:

EPOR cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1008 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human erythropoietin receptor, transcript variant 2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 1.06kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

EPOR cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EPOR cDNA ORF Clone, Human, C-DDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

EPOR cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

EPO-R cDNA ORF Clone, Human

EPOR Background Information

Erythropoietin (EPO) is the major glycoprotein hormone regulator of mammalian erythropoiesis, and is produced by kidney and liver in an oxygen-dependent manner. The biological effects of EPO are mediated by the specific erythropoietin receptor (EPOR/EPO Receptor) on bone marrow erythroblasts, which transmits signals important for both proliferation and differentiation along the erythroid lineage. EPOR protein is a type â… single-transmembrane cytokine receptor, and belongs to the homodimerizing subclass which functions as ligand-induced or ligand-stabilized homodimers. EPOR signaling prevents neuronal death and ischemic injury. Recent studies have shown that EPO and EPOR protein may be involved in carcinogenesis, angiogenesis, and invasion.
Full Name
erythropoietin receptor
References
  • Divoky V, et al. (2002) Mouse surviving solely on human erythropoietin receptor (EpoR): model of human EpoR-linked disease. Blood 99(10): 3873-4.
  • Carruthers SG. (2009) A truncated erythropoietin receptor EPOR-T is associated with hypertension susceptibility. Clin Pharmacol Ther. 86(2): 134-6.
  • Baltaziak M, et al. (2009) Relationships of P53 and Bak with EPO and EPOR in human colorectal cancer. Anticancer Res. 29(10):4151-6.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait