Быстрый заказ

Text Size:AAA

Человек EPOR/Erythropoietin Receptor transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human EPOR Информация о продукте «Клон cDNA»
Размер кДНК:1008bp
Описание кДНК:Full length Clone DNA of Homo sapiens erythropoietin receptor, transcript variant 2 with C terminal Flag tag.
Синоним гена:EPO-R, MGC138358, EPOR
Участок рестрикции:KpnI + XbaI (6kb + 1.06kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human EPOR Gene Plasmid Map
Human EPOR transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
Human EPOR Gene Expression validated Image
Human EPOR transcript variant 2 ORF mammalian expression plasmid, C-Flag tag
[Щелкните, чтобы увеличить изображение]
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек EPOR/Erythropoietin Receptor transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек EPOR/Erythropoietin Receptor transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13305-ACGRBS15400
Человек EPOR/Erythropoietin Receptor transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13305-ACRRBS15400
Человек EPOR/Erythropoietin Receptor transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13305-CFRBS13340
Человек EPOR/Erythropoietin Receptor transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13305-CHRBS13340
Человек EPOR/Erythropoietin Receptor transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13305-CMRBS13340
Человек EPOR/Erythropoietin Receptor transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13305-CYRBS13340
Человек EPOR/Erythropoietin Receptor transcript variant 2 Джин клон кДНК в вектор клонированияHG13305-GRBS5130
Человек EPOR/Erythropoietin Receptor transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13305-NFRBS13340
Человек EPOR/Erythropoietin Receptor transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13305-NHRBS13340
Человек EPOR/Erythropoietin Receptor transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13305-NMRBS13340
Человек EPOR/Erythropoietin Receptor transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13305-NYRBS13340
Человек EPOR/Erythropoietin Receptor transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыHG13305-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Erythropoietin (EPO) is the major glycoprotein hormone regulator of mammalian erythropoiesis, and is produced by kidney and liver in an oxygen-dependent manner. The biological effects of EPO are mediated by the specific erythropoietin receptor (EPOR/EPO Receptor) on bone marrow erythroblasts, which transmits signals important for both proliferation and differentiation along the erythroid lineage. EPOR protein is a type â…  single-transmembrane cytokine receptor, and belongs to the homodimerizing subclass which functions as ligand-induced or ligand-stabilized homodimers. EPOR signaling prevents neuronal death and ischemic injury. Recent studies have shown that EPO and EPOR protein may be involved in carcinogenesis, angiogenesis, and invasion.

  • Divoky V, et al. (2002) Mouse surviving solely on human erythropoietin receptor (EpoR): model of human EpoR-linked disease. Blood 99(10): 3873-4.
  • Carruthers SG. (2009) A truncated erythropoietin receptor EPOR-T is associated with hypertension susceptibility. Clin Pharmacol Ther. 86(2): 134-6.
  • Baltaziak M, et al. (2009) Relationships of P53 and Bak with EPO and EPOR in human colorectal cancer. Anticancer Res. 29(10):4151-6.
  • Size / Price
    Каталог: HG13305-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Human EPOR transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
    • Human EPOR transcript variant 2 ORF mammalian expression plasmid, C-Flag tag
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.