EphB3 cDNA ORF Clone, Human, C-DDK (Flag®) tag

1/1
Price:
Size:
Number:

EphB3 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3036 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1053T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human EPH receptor B3 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+3.04kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

EphB3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EphB3 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Validated Images

EphB3 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

ETK2 cDNA ORF Clone, Human; HEK2 cDNA ORF Clone, Human; TYRO6 cDNA ORF Clone, Human

EphB3 Background Information

Ephrin type-B receptor 3, also known as EphB3 or HEK2, belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family which 16 known receptors (14 found in mammals) are involved: EPHA1, EPHA2, EPHA3, EPHA4, EPHA5, EPHA6, EPHA7, EPHA8, EPHA9, EPHA1, EPHB1, EPHB2, EPHB3, EPHB4, EPHB5, EPHB6. The Eph family of receptor tyrosine kinases (comprising EphA and EphB receptors) has been implicated in synapse formation and the regulation of synaptic function and plasticity6. Ephrin receptors are components of cell signalling pathways involved in animal growth and development, forming the largest sub-family of receptor tyrosine kinases (RTKs). Ligand-mediated activation of Ephs induce various important downstream effects and Eph receptors have been studied for their potential roles in the development of cancer. EphB receptor tyrosine kinases are enriched at synapses, suggesting that these receptors play a role in synapse formation or function. We find that EphrinB binding to EphB induces a direct interaction of EphB with NMDA-type glutamate receptors. This interaction occurs at the cell surface and is mediated by the extracellular regions of the two receptors, but does not require the kinase activity of EphB.
Full Name
EPH receptor B3
References
  • Bergemann AD, et al. (1998) Ephrin-B3, a ligand for the receptor EphB3, expressed at the midline of the developing neural tube. Oncogene. 16(4): 471-80.
  • Hock B, et al. (1998) PDZ-domain-mediated interaction of the Eph-related receptor tyrosine kinase EphB3 and the ras-binding protein AF6 depends on the kinase activity of the receptor. Proc Natl Acad Sci U S A. 95(17): 9779-84.
  • Liu X, et al. (2006) EphB3: an endogenous mediator of adult axonal plasticity and regrowth after CNS injury. J Neurosci. 26(12): 3087-101.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait