Быстрый заказ

Человек EphB3/HEK2/Eph Receptor B3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human EPHB3 Информация о продукте «Клон cDNA»
Размер кДНК:2997bp
Описание кДНК:Full length Clone DNA of Homo sapiens EPH receptor B3 with C terminal Flag tag.
Синоним гена:ETK2, HEK2, TYRO6
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек EphB3/HEK2/Eph Receptor B3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек EphB3/HEK2/Eph Receptor B3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13925-ACGRBS22240
Человек EphB3/HEK2/Eph Receptor B3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13925-ACRRBS22240
Человек EphB3/HEK2/Eph Receptor B3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13925-CFRBS20190
Человек EphB3/HEK2/Eph Receptor B3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13925-CHRBS20190
Человек EphB3/HEK2/Eph Receptor B3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13925-CMRBS20190
Человек EphB3/HEK2/Eph Receptor B3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13925-CYRBS20190
Человек EphB3/HEK2/Eph Receptor B3 Джин клон кДНК в вектор клонированияHG13925-GRBS5130
Человек EphB3/HEK2/Eph Receptor B3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13925-NFRBS20190
Человек EphB3/HEK2/Eph Receptor B3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13925-NHRBS20190
Человек EphB3/HEK2/Eph Receptor B3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13925-NMRBS20190
Человек EphB3/HEK2/Eph Receptor B3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13925-NYRBS20190
Человек EphB3/HEK2/Eph Receptor B3 Джин ORF экспрессии кДНК клона плазмидыHG13925-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Ephrin type-B receptor 3, also known as EphB3 or HEK2, belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family which 16 known receptors (14 found in mammals) are involved: EPHA1, EPHA2, EPHA3, EPHA4, EPHA5, EPHA6, EPHA7, EPHA8, EPHA9, EPHA10, EPHB1, EPHB2, EPHB3, EPHB4, EPHB5, EPHB6. The Eph family of receptor tyrosine kinases (comprising EphA and EphB receptors) has been implicated in synapse formation and the regulation of synaptic function and plasticity6. Ephrin receptors are components of cell signalling pathways involved in animal growth and development, forming the largest sub-family of receptor tyrosine kinases (RTKs). Ligand-mediated activation of Ephs induce various important downstream effects and Eph receptors have been studied for their potential roles in the development of cancer. EphB receptor tyrosine kinases are enriched at synapses, suggesting that these receptors play a role in synapse formation or function. We find that EphrinB binding to EphB induces a direct interaction of EphB with NMDA-type glutamate receptors. This interaction occurs at the cell surface and is mediated by the extracellular regions of the two receptors, but does not require the kinase activity of EphB.

  • Bergemann AD, et al. (1998) Ephrin-B3, a ligand for the receptor EphB3, expressed at the midline of the developing neural tube. Oncogene. 16(4): 471-80.
  • Hock B, et al. (1998) PDZ-domain-mediated interaction of the Eph-related receptor tyrosine kinase EphB3 and the ras-binding protein AF6 depends on the kinase activity of the receptor. Proc Natl Acad Sci U S A. 95(17): 9779-84.
  • Liu X, et al. (2006) EphB3: an endogenous mediator of adult axonal plasticity and regrowth after CNS injury. J Neurosci. 26(12): 3087-101.
  • Size / Price
    Каталог: HG13925-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.