Быстрый заказ

Text Size:AAA

Человек EphA1/Eph Receptor A1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human EPHA1 Информация о продукте «Клон cDNA»
Размер кДНК:2931bp
Описание кДНК:Full length Clone DNA of Homo sapiens EPH receptor A1 with N terminal HA tag.
Синоним гена:EPH, EPHT, EPHT1
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек EphA1/Eph Receptor A1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек EphA1/Eph Receptor A1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15789-ACGRBS22240
Человек EphA1/Eph Receptor A1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15789-ACRRBS22240
Человек EphA1/Eph Receptor A1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15789-CFRBS20190
Человек EphA1/Eph Receptor A1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15789-CHRBS20190
Человек EphA1/Eph Receptor A1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15789-CMRBS20190
Человек EphA1/Eph Receptor A1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15789-CYRBS20190
Человек EphA1/Eph Receptor A1 Джин клон кДНК в вектор клонированияHG15789-GRBS5130
Человек EphA1/Eph Receptor A1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15789-NFRBS20190
Человек EphA1/Eph Receptor A1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15789-NHRBS20190
Человек EphA1/Eph Receptor A1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15789-NMRBS20190
Человек EphA1/Eph Receptor A1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15789-NYRBS20190
Человек EphA1/Eph Receptor A1 Джин ORF экспрессии кДНК клона плазмидыHG15789-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name

EPHA1 or EPH receptor A1 belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. An important role of Eph receptors and their ligands ephrins is to mediate cell-contact-dependent repulsion. Eph receptors and ephrins also act at boundaries to channel neuronal growth cones along specific pathways, restrict the migration of neural crest cells, and via bidirectional signaling prevent intermingling between hindbrain segments. Eph receptors and ephrins can also trigger an adhesive response of endothelial cells and are required for the remodeling of blood vessels. Eph receptors and ephrins have emerged as key regulators of the repulsion and adhesion of cells that underlie the establishment, maintainence, and remodeling of patterns of cellular organization. The ephrins and Eph receptors are implicated as positional labels that may guide the development of neural topographic maps.

  • Flanagan JG, et al. (1998) THE EPHRINS AND EPH RECEPTORS IN NEURAL DEVELOPMENT. Annual Review of Neuroscience. 21: 309-45.
  • Wilkinson DG (2000) Eph receptors and ephrins: Regulators of guidance and assembly. International Review of Cytology. 196: 177-244.
  • Zhou R. (1998) The Eph family receptors and ligands. Pharmacol. 77 (3): 151-81.
  • Size / Price
    Каталог: HG15789-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.