After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек EPDR1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human EPDR1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC018299
Размер кДНК:675bp
Описание кДНК:Full length Clone DNA of Homo sapiens ependymin related protein 1 (zebrafish) with N terminal His tag.
Синоним гена:EPDR, UCC1, MERP1, MERP-1, EPDR1
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек EPDR1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек EPDR1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13665-ACGRBS15400
Человек EPDR1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13665-ACRRBS15400
Человек EPDR1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13665-CFRBS13340
Человек EPDR1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13665-CHRBS13340
Человек EPDR1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13665-CMRBS13340
Человек EPDR1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13665-CYRBS13340
Человек EPDR1 Джин клон кДНК в вектор клонированияHG13665-GRBS5130
Человек EPDR1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13665-NFRBS13340
Человек EPDR1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13665-NHRBS13340
Человек EPDR1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13665-NMRBS13340
Человек EPDR1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13665-NYRBS13340
Человек EPDR1 Джин ORF экспрессии кДНК клона плазмидыHG13665-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

EPDR1 is a member of the ependymin family. EPDR1 is a type II transmembrane protein that is similar to two families of cell adhesion molecules, the protocadherins and ependymins. It may play a role in calcium-dependent cell adhesion. EPDR1 is glycosylated, and the orthologous mouse protein is localized to the lysosome. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 8.

Ссылки
  • Suga T. et al., 2008, Int J Radiat Oncol Biol Phys. 72 (3): 808-13.
  • Rose JE. et al., 2010, Mol Med. 16 (7-8): 247-53.
  • Cheng W. et al., 2010, J Huazhong Univ Sci Technolog Med Sci. 30 (3): 391-6.
  • Size / Price
    Каталог: HG13665-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».