After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек ENTPD5 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human ENTPD5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001249.2
Размер кДНК:1287bp
Описание кДНК:Full length Clone DNA of Homo sapiens ectonucleoside triphosphate diphosphohydrolase 5.
Синоним гена:PCPH, CD39L4, MGC163357, MGC163359, NTPDase-5, ENTPD5
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-ENTPD5
Участок рестрикции:HindIII + NotI (6.1kb + 1.29kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human ENTPD5 Gene Plasmid Map
Human ENTPD5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек ENTPD5 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11184-ACGRBS15400
Человек ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11184-ACRRBS15400
Человек ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11184-CFRBS13340
Человек ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11184-CHRBS13340
Человек ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11184-CMRBS13340
Человек ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11184-CYRBS13340
Человек ENTPD5 Джин клон кДНК в вектор клонированияHG11184-MRBS5130
Человек ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11184-M-FRBS13340
Человек ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11184-NFRBS13340
Человек ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11184-NHRBS13340
Человек ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11184-NMRBS13340
Человек ENTPD5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11184-NYRBS13340
Человек ENTPD5 Джин ORF экспрессии кДНК клона плазмидыHG11184-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Ectonucleoside triphosphate diphosphohydrolase 5 (ENTPD5), also known as CD39 antigen-like 4, ER-UDPase, Guanosine-diphosphatase ENTPD5, Nucleoside diphosphatase Uridine-diphosphatase ENTPD5. This hydrolase is expressed in response to phosphoinositide 3-kinase (PI3K) signaling. Activation of PI3K results in FOXO phosphorylation by AKT1 and loss of ENTPD5 transcriptional repression. It is Up-regulated in PTEN-deficient cells. Uridine diphosphatase (UDPase) that promotes protein N-glycosylation and ATP level regulation.ENTPD5 promotes protein N-glycosylation and folding in the endoplasmic reticulum, as well as elevated ATP consumption in the cytosol via an ATP hydrolysis cycle. Together with CMPK1 and AK1, ENTPD5 constitutes an ATP hydrolysis cycle that converts ATP to AMP and results in a compensatory increase in aerobic glycolysis. ENTPD5 also hydrolyzes GDP and IDP but not any other nucleoside di-, mono- or triphosphates, nor thiamine pyrophosphate. This enzyme Plays a key role in the AKT1-PTEN signaling pathway by promoting glycolysis in proliferating cells in response to phosphoinositide 3-kinase (PI3K) signaling.

Ссылки
  • Villar J, et al. (2009) PCPH/ENTPD5 expression confers to prostate cancer cells resistance against cisplatin-induced apoptosis through protein kinase Calpha-mediated Bcl-2 stabilization. Cancer Res. 69(1): 102-10.
  • Fang M, et al. (2010) The ER UDPase ENTPD5 promotes protein N-glycosylation, the Warburg effect, and proliferation in the PTEN pathway. Cell. 143(5): 711-24.
  • Paez JG, et al. (2001) Identity between the PCPH proto-oncogene and the CD39L4 (ENTPD5) ectonucleoside triphosphate diphosphohydrolase gene. Int J Oncol. 19(6): 1249-54.
  • Size / Price
    Каталог: HG11184-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human ENTPD5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».