Быстрый заказ

Человек ENSA / Endosulfine alpha Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ENSA Информация о продукте «Клон cDNA»
Размер кДНК:366bp
Описание кДНК:Full length Clone DNA of Homo sapiens endosulfine alpha with N terminal Myc tag.
Синоним гена:RP11-54A4.10-004, ARPP-19e, MGC4319, MGC78563, MGC8394, ENSA
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек ENSA / Endosulfine alpha Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек ENSA / Endosulfine alpha Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14321-ACGRBS15400
Человек ENSA / Endosulfine alpha Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14321-ACRRBS15400
Человек ENSA / Endosulfine alpha Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14321-ANGRBS15400
Человек ENSA / Endosulfine alpha Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14321-ANRRBS15400
Человек ENSA / Endosulfine alpha Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14321-CFRBS13340
Человек ENSA / Endosulfine alpha Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14321-CHRBS13340
Человек ENSA / Endosulfine alpha Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14321-CMRBS13340
Человек ENSA / Endosulfine alpha Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14321-CYRBS13340
Человек ENSA / Endosulfine alpha Джин клон кДНК в вектор клонированияHG14321-GRBS5130
Человек ENSA / Endosulfine alpha Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14321-NFRBS13340
Человек ENSA / Endosulfine alpha Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14321-NHRBS13340
Человек ENSA / Endosulfine alpha Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14321-NMRBS13340
Человек ENSA / Endosulfine alpha Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14321-NYRBS13340
Человек ENSA / Endosulfine alpha Джин ORF экспрессии кДНК клона плазмидыHG14321-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Endosulfine alpha, also known as ENSA, belongs to the endosulfine family. It is a highly conserved cAMP-regulated phosphoprotein (ARPP) family. Endosulfine alpha is widely expressed with high levels in skeletal muscle and brain and lower levels in the pancreas. As a protein phosphatase inhibitor, ENSA specifically inhibits protein phosphatase 2A (PP2A) during mitosis. When phosphorylated at Ser-67 during mitosis, specifically interacts with PPP2R2D (PR55-delta) and inhibits its activity, leading to inactivation of PP2A, an essential condition to keep cyclin-B1-CDK1 activity high during M phase By similarity. Endosulfine alpha also acts as a stimulator of insulin secretion by interacting with sulfonylurea receptor (ABCC8), thereby preventing sulfonylurea from binding to its receptor and reducing K(ATP) channel currents.

  • Ye M. et al., 2001, Genome Res. 10 (10): 1546-60.
  • Apiou F. et al., 1999, Diabetes 48 (9): 1873-6.
  • Lennon G. et al., 1997, Genome Res. 6 (9): 791-806.
  • Size / Price
    Каталог: HG14321-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.