Быстрый заказ

Text Size:AAA

Человек ENO3 / beta-enolase Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ENO3 Информация о продукте «Клон cDNA»
Размер кДНК:1305bp
Описание кДНК:Full length Clone DNA of Homo sapiens enolase 3 (beta, muscle) with N terminal His tag.
Синоним гена:GSD13, MSE, ENO3
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек ENO3 / beta-enolase Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек ENO3 / beta-enolase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14270-ACGRBS15400
Человек ENO3 / beta-enolase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14270-ACRRBS15400
Человек ENO3 / beta-enolase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14270-ANGRBS15400
Человек ENO3 / beta-enolase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14270-ANRRBS15400
Человек ENO3 / beta-enolase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14270-CFRBS13340
Человек ENO3 / beta-enolase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14270-CHRBS13340
Человек ENO3 / beta-enolase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14270-CMRBS13340
Человек ENO3 / beta-enolase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14270-CYRBS13340
Человек ENO3 / beta-enolase Джин клон кДНК в вектор клонированияHG14270-GRBS5130
Человек ENO3 / beta-enolase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14270-NFRBS13340
Человек ENO3 / beta-enolase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14270-NHRBS13340
Человек ENO3 / beta-enolase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14270-NMRBS13340
Человек ENO3 / beta-enolase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14270-NYRBS13340
Человек ENO3 / beta-enolase Джин ORF экспрессии кДНК клона плазмидыHG14270-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

ENO3 is one of the three enolase isoenzymes found in mammals. As a homodimer, ENO3 is found in skeletal muscle cells in the adult. A switch from alpha enolase to beta enolase occurs in muscle tissue during development in rodents. Mutations in ENO3 gene can be associated with metabolic myopathies that may result from decreased stability of the enzyme. Two transcripts have been identified for ENO3 gene that differ only in their 5' UTR. ENO3 may play a role in muscle development and regeneration. It appears to have a function in striated muscle development and regeneration.

  • Peshavaria M, et al. (1989) Structure of human muscle (beta) enolase mRNA and protein deduced from a genomic clone. Nucleic Acids Res. 17(21):8862.
  • Calì L, et al. (1990) Nucleotide sequence of a cDNA encoding the human muscle-specific enolase (MSE). Nucleic Acids Res. 18(7):1893.
  • Peshavaria M, et al. (1991) Molecular structure of the human muscle-specific enolase gene (ENO3). Biochem J. 275(2):427-33.
  • Size / Price
    Каталог: HG14270-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.