After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек ENO2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ENO2 Информация о продукте «Клон cDNA»
Размер кДНК:1305bp
Описание кДНК:Full length Clone DNA of Homo sapiens enolase 2 (gamma, neuronal) with N terminal Flag tag.
Синоним гена:NSE
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек ENO2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек ENO2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14573-ACGRBS15400
Человек ENO2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14573-ACRRBS15400
Человек ENO2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14573-ANGRBS15400
Человек ENO2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14573-ANRRBS15400
Человек ENO2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14573-CFRBS13340
Человек ENO2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14573-CHRBS13340
Человек ENO2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14573-CMRBS13340
Человек ENO2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14573-CYRBS13340
Человек ENO2 Джин клон кДНК в вектор клонированияHG14573-GRBS5130
Человек ENO2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14573-NFRBS13340
Человек ENO2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14573-NHRBS13340
Человек ENO2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14573-NMRBS13340
Человек ENO2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14573-NYRBS13340
Человек ENO2 Джин ORF экспрессии кДНК клона плазмидыHG14573-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
  • Pechumer H, et al. (1994) Detection of neuron-specific gamma-enolase messenger ribonucleic acid in normal human leukocytes by polymerase chain reaction amplification with nested primers. Lab Invest. 69 (6): 743-9.
  • Craig SP, et al. (1991) Localisation of neurone-specific enolase (ENO2) to 12p13. Cytogenet Cell Genet. 54 (1-2): 71-3.
  • Muley T, et al. (2003) Technical performance and diagnostic utility of the new Elecsys neuron-specific enolase enzyme immunoassay. Clin Chem Lab Med. 41 (1): 95-103.
  • Size / Price
    Каталог: HG14573-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.