Быстрый заказ

Человек TMEM111 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек EMC3 Информация о продукте «Клон cDNA»
    Размер кДНК:786bp
    Описание кДНК:Full length Clone DNA of Homo sapiens ER membrane protein complex subunit 3 with N terminal Flag tag.
    Синоним гена:POB, TMEM111
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    ( We provide with EMC3 qPCR primers for gene expression analysis, HP105095 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Человек TMEM111 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
    Человек TMEM111 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16342-ACGRBS15400
    Человек TMEM111 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16342-ACRRBS15400
    Человек TMEM111 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16342-CFRBS13340
    Человек TMEM111 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16342-CHRBS13340
    Человек TMEM111 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16342-CMRBS13340
    Человек TMEM111 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16342-CYRBS13340
    Человек TMEM111 Джин клон кДНК в вектор клонированияHG16342-GRBS5130
    Человек TMEM111 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16342-NFRBS13340
    Человек TMEM111 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16342-NHRBS13340
    Человек TMEM111 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16342-NMRBS13340
    Человек TMEM111 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16342-NYRBS13340
    Человек TMEM111 Джин ORF экспрессии кДНК клона плазмидыHG16342-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.