Быстрый заказ

Человек TMEM111 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human EMC3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_018447.2
Размер кДНК:786bp
Описание кДНК:Full length Clone DNA of Homo sapiens ER membrane protein complex subunit 3 with C terminal His tag.
Синоним гена:POB, TMEM111
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек TMEM111 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек TMEM111 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16342-ACGRBS15400
Человек TMEM111 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16342-ACRRBS15400
Человек TMEM111 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16342-CFRBS13340
Человек TMEM111 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16342-CHRBS13340
Человек TMEM111 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16342-CMRBS13340
Человек TMEM111 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16342-CYRBS13340
Человек TMEM111 Джин клон кДНК в вектор клонированияHG16342-GRBS5130
Человек TMEM111 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16342-NFRBS13340
Человек TMEM111 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16342-NHRBS13340
Человек TMEM111 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16342-NMRBS13340
Человек TMEM111 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16342-NYRBS13340
Человек TMEM111 Джин ORF экспрессии кДНК клона плазмидыHG16342-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16342-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».