After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек EIF5A Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human EIF5A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC000751
Размер кДНК:465bp
Описание кДНК:Full length Clone DNA of Homo sapiens eukaryotic translation initiation factor 5A with C terminal Flag tag.
Синоним гена:EIF-5A, EIF5A1, eIF5AI
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек EIF5A Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек EIF5A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15096-ACGRBS15400
Человек EIF5A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15096-ACRRBS15400
Человек EIF5A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15096-ANGRBS15400
Человек EIF5A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15096-ANRRBS15400
Человек EIF5A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15096-CFRBS13340
Человек EIF5A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15096-CHRBS13340
Человек EIF5A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15096-CMRBS13340
Человек EIF5A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15096-CYRBS13340
Человек EIF5A Джин клон кДНК в вектор клонированияHG15096-GRBS5130
Человек EIF5A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15096-NFRBS13340
Человек EIF5A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15096-NHRBS13340
Человек EIF5A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15096-NMRBS13340
Человек EIF5A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15096-NYRBS13340
Человек EIF5A Джин ORF экспрессии кДНК клона плазмидыHG15096-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

EIF-5A, also known as EIF5, functions in start site selection as a GTPase accelerating protein (GAP) for the eukaryotic translation initiation factor (eIF) 2•GTP•tRNA ternary complex within the ribosome-bound pre-initiation complex. In protein synthesis initiation, eIF2 functions in its GTP-bound state to deliver initiator methionyl-tRNA to the small ribosomal subunit and is necessary for protein synthesis in all cells. EIF-5A stabilizes the binding of GDP to eIF2 and is therefore a bi-functional protein that acts as a GDP dissociation inhibitor (GDI). EIF-5A also interacts with eIF1 and eIF3 and binds the eIF2-GTP/Met-tRNA ternary complex along with the 40S ribosome subunit.

Ссылки
  • Jenkins ZA. et al., 2001, Genomics. 71 (1): 101-9.
  • Guan XY. et al., 2001, Cancer Res. 61 (9): 3806-9.
  • Strausberg RL. et al., 2003, Proc Natl Acad Sci. 99 (26): 16899-903.
  • Clement PM. et al., 2003, Eur J Biochem. 270 (21): 4254-63.
  • Size / Price
    Каталог: HG15096-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».