Быстрый заказ

Человек EIF-5A/EIF5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек EIF5 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC007728
    Размер кДНК:1296bp
    Описание кДНК:Full length Clone DNA of Homo sapiens eukaryotic translation initiation factor 5 with C terminal Flag tag.
    Синоним гена:EIF-5, EIF-5A
    Виды:Human
    переносчик:pCMV3-C-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with EIF5 qPCR primers for gene expression analysis, HP102589 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Человек EIF-5A/EIF5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
    Человек EIF-5A/EIF5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13932-ACGRBS15400
    Человек EIF-5A/EIF5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13932-ACRRBS15400
    Человек EIF-5A/EIF5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13932-ANGRBS15400
    Человек EIF-5A/EIF5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13932-ANRRBS15400
    Человек EIF-5A/EIF5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13932-CFRBS13340
    Человек EIF-5A/EIF5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13932-CHRBS13340
    Человек EIF-5A/EIF5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13932-CMRBS13340
    Человек EIF-5A/EIF5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13932-CYRBS13340
    Человек EIF-5A/EIF5 Джин клон кДНК в вектор клонированияHG13932-GRBS5130
    Человек EIF-5A/EIF5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13932-NFRBS13340
    Человек EIF-5A/EIF5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13932-NHRBS13340
    Человек EIF-5A/EIF5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13932-NMRBS13340
    Человек EIF-5A/EIF5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13932-NYRBS13340
    Человек EIF-5A/EIF5 Джин ORF экспрессии кДНК клона плазмидыHG13932-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    EIF-5A, also known as EIF5, functions in start site selection as a GTPase accelerating protein (GAP) for the eukaryotic translation initiation factor (eIF) 2•GTP•tRNA ternary complex within the ribosome-bound pre-initiation complex. In protein synthesis initiation, eIF2 functions in its GTP-bound state to deliver initiator methionyl-tRNA to the small ribosomal subunit and is necessary for protein synthesis in all cells. EIF-5A stabilizes the binding of GDP to eIF2 and is therefore a bi-functional protein that acts as a GDP dissociation inhibitor (GDI). EIF-5A also interacts with eIF1 and eIF3 and binds the eIF2-GTP/Met-tRNA ternary complex along with the 40S ribosome subunit.

    Ссылки
  • Si K, et al. (1996) Charactatierizon of multiple mRNAs that encode mammalian translation initiation factor 5 (eIF-5). J Biol Chem. 71(28):16934.
  • Das S, et al. (1998) Specific interaction of eukaryotic translation initiation factor 5 (eIF5) with the beta-subunit of eIF2. J Biol Chem. 272(50):31712-8.
  • Conte MR, et al. (2006) Structure of the eukaryotic initiation factor (eIF) 5 reveals a fold common to several translation factors. Biochemistry. 45(14):4550-8.
  • Size / Price
    Каталог: HG13932-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».