Быстрый заказ

Человек eIF2AK1/HRI Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек EIF2AK1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_014413.3
    Размер кДНК:1893bp
    Описание кДНК:Full length Clone DNA of Homo sapiens eukaryotic translation initiation factor 2-alpha kinase 1.
    Синоним гена:HCR, HRI, KIAA1369, EIF2AK1
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with EIF2AK1 qPCR primers for gene expression analysis, HP100631 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек eIF2AK1/HRI Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек eIF2AK1/HRI Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10663-ACGRBS16760
    Человек eIF2AK1/HRI Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10663-ACRRBS16760
    Человек eIF2AK1/HRI Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10663-ANGRBS16760
    Человек eIF2AK1/HRI Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10663-ANRRBS16760
    Человек eIF2AK1/HRI Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10663-CFRBS14710
    Человек eIF2AK1/HRI Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10663-CHRBS14710
    Человек eIF2AK1/HRI Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10663-CMRBS14710
    Человек eIF2AK1/HRI Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10663-CYRBS14710
    Человек eIF2AK1/HRI Джин клон кДНК в вектор клонированияHG10663-MRBS5130
    Человек eIF2AK1/HRI Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10663-M-FRBS14710
    Человек eIF2AK1/HRI Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10663-NFRBS14710
    Человек eIF2AK1/HRI Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10663-NHRBS14710
    Человек eIF2AK1/HRI Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10663-NMRBS14710
    Человек eIF2AK1/HRI Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10663-NYRBS14710
    Человек eIF2AK1/HRI Джин ORF экспрессии кДНК клона плазмидыHG10663-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG10663-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».