Быстрый заказ

Text Size:AAA

Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human EFNA4 Информация о продукте «Клон cDNA»
Размер кДНК:606bp
Описание кДНК:Full length Clone DNA of Homo sapiens ephrin-A4 with N terminal Flag tag.
Синоним гена:LERK4
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12087-ACGRBS15400
Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12087-ACRRBS15400
Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12087-CFRBS13340
Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12087-CHRBS13340
Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12087-CMRBS13340
Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12087-CYRBS13340
Человек Ephrin-A4/EFNA4 Джин клон кДНК в вектор клонированияHG12087-GRBS5130
Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12087-NFRBS13340
Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12087-NHRBS13340
Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12087-NMRBS13340
Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12087-NYRBS13340
Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмидыHG12087-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

EPH-related receptor tyrosine kinase ligand 4 (Ephrin-A4) also known as EFNA4, is a member of the Ephrin family. The Eph family receptor interacting proteins (ephrins) are a family of proteins that serve as the ligands of the Eph receptor, which compose the largest known subfamily of receptor protein-tyrosine kinases (RTKs). Eph/ephrin interactions are implicated in axon guidance, neural crest cell migration, establishment of segmental boundaries, and formation of angiogenic capillary plexi. Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: ephrin-A ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. An exception is the EphA4 receptor, which binds both subclasses of ephrins. Ephrin-A4/EFNA4 functions as a cell surface GPI-bound ligand for Eph receptor, a family of receptor tyrosine kinases which are crucial for migration, repulsion and adhesion during neuronal, vascular and epithelial development.

  • Aasheim HC, et al. (2000) A splice variant of human ephrin-A4 encodes a soluble molecule that is secreted by activated human B lymphocytes. Blood. 95(1): 221-30.
  • Moss A, et al. (2005) Ephrin-A4 inhibits sensory neurite outgrowth and is regulated by neonatal skin wounding. Eur J Neurosci. 22(10): 2413-21.
  • Cerretti DP, et al. (1998) Characterization of the genes for mouse LERK-3/Ephrin-A3 (Epl3), mouse LERK-4/Ephrin-A4 (Epl4), and human LERK-6/Ephrin-A2 (EPLG6): conservation of intron/exon structure. Genomics. 47(1): 131-5.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.