Быстрый заказ

Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек EFNA4 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_005227
    Размер кДНК:606bp
    Описание кДНК:Full length Clone DNA of Homo sapiens ephrin-A4 with C terminal HA tag.
    Синоним гена:LERK4
    Виды:Human
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with EFNA4 qPCR primers for gene expression analysis, HP101615 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12087-ACGRBS15400
    Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12087-ACRRBS15400
    Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12087-CFRBS13340
    Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12087-CHRBS13340
    Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12087-CMRBS13340
    Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12087-CYRBS13340
    Человек Ephrin-A4/EFNA4 Джин клон кДНК в вектор клонированияHG12087-GRBS5130
    Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12087-NFRBS13340
    Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12087-NHRBS13340
    Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12087-NMRBS13340
    Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12087-NYRBS13340
    Человек Ephrin-A4/EFNA4 Джин ORF экспрессии кДНК клона плазмидыHG12087-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    EPH-related receptor tyrosine kinase ligand 4 (Ephrin-A4) also known as EFNA4, is a member of the Ephrin family. The Eph family receptor interacting proteins (ephrins) are a family of proteins that serve as the ligands of the Eph receptor, which compose the largest known subfamily of receptor protein-tyrosine kinases (RTKs). Eph/ephrin interactions are implicated in axon guidance, neural crest cell migration, establishment of segmental boundaries, and formation of angiogenic capillary plexi. Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: ephrin-A ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. An exception is the EphA4 receptor, which binds both subclasses of ephrins. Ephrin-A4/EFNA4 functions as a cell surface GPI-bound ligand for Eph receptor, a family of receptor tyrosine kinases which are crucial for migration, repulsion and adhesion during neuronal, vascular and epithelial development.

    Ссылки
  • Aasheim HC, et al. (2000) A splice variant of human ephrin-A4 encodes a soluble molecule that is secreted by activated human B lymphocytes. Blood. 95(1): 221-30.
  • Moss A, et al. (2005) Ephrin-A4 inhibits sensory neurite outgrowth and is regulated by neonatal skin wounding. Eur J Neurosci. 22(10): 2413-21.
  • Cerretti DP, et al. (1998) Characterization of the genes for mouse LERK-3/Ephrin-A3 (Epl3), mouse LERK-4/Ephrin-A4 (Epl4), and human LERK-6/Ephrin-A2 (EPLG6): conservation of intron/exon structure. Genomics. 47(1): 131-5.
  • Size / Price
    Каталог: HG12087-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».