After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Human EEF1E1 ORF mammalian expression plasmid, C-His tag

ПаспортОбзорыСвязанные продуктыПротоколы
Human EEF1E1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC005291
Размер кДНК:525bp
Описание кДНК:Full length Clone DNA of Homo sapiens eukaryotic translation elongation factor 1 epsilon 1 with C terminal His tag.
Синоним гена:P18, AIMP3, EEF1E1
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Фон

EEF1E1, also known as AIMP3 and p18, is a multifunctional protein that localizes to both the cytoplasm and nucleus. In the cytoplasm, EEF1E1 is an auxiliary component of the macromolecular aminoacyl-tRNA synthase complex. It is comprised of a bifunctional glutamyl-prolyl-tRNA synthase, the monospecific isoleucyl, leucyl, glutaminyl, methionyl, lysyl, arginyl and aspartyl-tRNA synthases, and three auxiliary proteins, EEF1E1/p18, AIMP2/p38 and AIMP1/p43. EEF1E1 also plays a positive role in ATM/ATR-mediated p53 activation.

Ссылки
  • Mao M. et al., 1998, Proc Natl Acad Sci. 95 (14): 8175-80.
  • Quevillon S. et al., 1999, J Mol Biol. 285 (1): 183-95.
  • Ahn HC. et al., 2003, FEBS Lett. 542 (1-3): 119-24.
  • Size / Price
    Каталог: HG14004-CH
    Цена по прейскуранту:   (Save )
    Цена:      [How to order]
    Наличие2-3 weeksИнструкции по доставке
    Изображения
        Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».