After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human EEF1B2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC000211
Размер кДНК:678bp
Описание кДНК:Full length Clone DNA of Homo sapiens eukaryotic translation elongation factor 1 beta 2 with C terminal HA tag.
Синоним гена:EF1B, EEF1B, EEF1B1
Виды:Human
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14611-ACGRBS15400
Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14611-ACRRBS15400
Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14611-ANGRBS15400
Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14611-ANRRBS15400
Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14611-CFRBS13340
Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14611-CHRBS13340
Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14611-CMRBS13340
Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14611-CYRBS13340
Человек EF1B / EEF1B2 Джин клон кДНК в вектор клонированияHG14611-GRBS5130
Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14611-NFRBS13340
Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14611-NHRBS13340
Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14611-NMRBS13340
Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14611-NYRBS13340
Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмидыHG14611-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

EF1B, also known as EEF1B2, is a translation elongation factor. It belongs to the EF-1-beta/EF-1-delta family. Elongation factors are a set of proteins that are used in protein synthesis in the cell. In the ribosome, they facilitate translational elongation, from the formation of the first peptide bond to the formation of the last one. EF1B is more complex in eukaryotes than in bacteria, and consists of three subunits: EF1B-alpha, EF1B-gamma and EF1B-beta. EF1B contains 1 GST C-terminal domain. It is involved in the transfer of aminoacylated tRNAs to the ribosome. EF1B is required to regenerate EF1A from its inactive form (EF1A-GDP) to its active form (EF1A-GTP). EF1A is then ready to interact with a new aminoacyl-tRNA to begin the cycle again.

Ссылки
  • Pizzuti A. et al., 1994, Biochem Biophys Res Commun. 197 (1): 154-62.
  • Rual. et al., 2005, Nature. 437 (7062): 1173-8.
  • Stelzl. et al., 2005, Cell. 122 (6): 957-68.
  • Sang Lee. et al., 2002, Biochem Biophys Res Commun. 291 (1): 158-64.
  • Size / Price
    Каталог: HG14611-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».