Быстрый заказ

Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек EEF1B2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC000211
    Размер кДНК:678bp
    Описание кДНК:Full length Clone DNA of Homo sapiens eukaryotic translation elongation factor 1 beta 2 with C terminal HA tag.
    Синоним гена:EF1B, EEF1B, EEF1B1
    Виды:Human
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with EEF1B2 qPCR primers for gene expression analysis, HP103245 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14611-ACGRBS15400
    Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14611-ACRRBS15400
    Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14611-ANGRBS15400
    Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14611-ANRRBS15400
    Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14611-CFRBS13340
    Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14611-CHRBS13340
    Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14611-CMRBS13340
    Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14611-CYRBS13340
    Человек EF1B / EEF1B2 Джин клон кДНК в вектор клонированияHG14611-GRBS5130
    Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14611-NFRBS13340
    Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14611-NHRBS13340
    Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14611-NMRBS13340
    Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14611-NYRBS13340
    Человек EF1B / EEF1B2 Джин ORF экспрессии кДНК клона плазмидыHG14611-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    EF1B, also known as EEF1B2, is a translation elongation factor. It belongs to the EF-1-beta/EF-1-delta family. Elongation factors are a set of proteins that are used in protein synthesis in the cell. In the ribosome, they facilitate translational elongation, from the formation of the first peptide bond to the formation of the last one. EF1B is more complex in eukaryotes than in bacteria, and consists of three subunits: EF1B-alpha, EF1B-gamma and EF1B-beta. EF1B contains 1 GST C-terminal domain. It is involved in the transfer of aminoacylated tRNAs to the ribosome. EF1B is required to regenerate EF1A from its inactive form (EF1A-GDP) to its active form (EF1A-GTP). EF1A is then ready to interact with a new aminoacyl-tRNA to begin the cycle again.

    Ссылки
  • Pizzuti A. et al., 1994, Biochem Biophys Res Commun. 197 (1): 154-62.
  • Rual. et al., 2005, Nature. 437 (7062): 1173-8.
  • Stelzl. et al., 2005, Cell. 122 (6): 957-68.
  • Sang Lee. et al., 2002, Biochem Biophys Res Commun. 291 (1): 158-64.
  • Size / Price
    Каталог: HG14611-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».