Быстрый заказ

Человек EDDM3B Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human EDDM3B Информация о продукте «Клон cDNA»
Размер кДНК:444bp
Описание кДНК:Full length Clone DNA of Homo sapiens epididymal protein 3B with N terminal Myc tag.
Синоним гена:EP3B, HE3B, FAM12B, HE3-BETA, EDDM3B
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек EDDM3B Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек EDDM3B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13739-ACGRBS15400
Человек EDDM3B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13739-ACRRBS15396
Человек EDDM3B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13739-CFRBS13343
Человек EDDM3B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13739-CHRBS13343
Человек EDDM3B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13739-CMRBS13340
Человек EDDM3B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13739-CYRBS13343
Человек EDDM3B Джин клон кДНК в вектор клонированияHG13739-GRBS5132
Человек EDDM3B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13739-NFRBS13343
Человек EDDM3B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13739-NHRBS13340
Человек EDDM3B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13739-NMRBS13340
Человек EDDM3B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13739-NYRBS13343
Человек EDDM3B Джин ORF экспрессии кДНК клона плазмидыHG13739-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13739-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.