Быстрый заказ

Text Size:AAA

Человек ECD / Ecdysoneless homolog Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ECD Информация о продукте «Клон cDNA»
Размер кДНК:1935bp
Описание кДНК:Full length Clone DNA of Homo sapiens ecdysoneless homolog (DrosophilA) with N terminal Myc tag.
Синоним гена:GCR2, HSGT1, ECD
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек ECD / Ecdysoneless homolog Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек ECD / Ecdysoneless homolog Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14311-ACGRBS16760
Человек ECD / Ecdysoneless homolog Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14311-ACRRBS16760
Человек ECD / Ecdysoneless homolog Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14311-ANGRBS16760
Человек ECD / Ecdysoneless homolog Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14311-ANRRBS16760
Человек ECD / Ecdysoneless homolog Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14311-CFRBS14710
Человек ECD / Ecdysoneless homolog Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14311-CHRBS14710
Человек ECD / Ecdysoneless homolog Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14311-CMRBS14710
Человек ECD / Ecdysoneless homolog Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14311-CYRBS14710
Человек ECD / Ecdysoneless homolog Джин клон кДНК в вектор клонированияHG14311-GRBS5130
Человек ECD / Ecdysoneless homolog Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14311-NFRBS14710
Человек ECD / Ecdysoneless homolog Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14311-NHRBS14710
Человек ECD / Ecdysoneless homolog Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14311-NMRBS14710
Человек ECD / Ecdysoneless homolog Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14311-NYRBS14710
Человек ECD / Ecdysoneless homolog Джин ORF экспрессии кДНК клона плазмидыHG14311-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

ECD, also known as ecdysoneless homolog, belongs to the SGT1 family. It is highly expressed in muscle and heart. ECD is a novel promoter of mammalian cell cycle progression. This function is related to its ability to remove the repressive effects of Rb-family tumor suppressors on E2F transcription factors. It is a novel tumor-promoting factor that is differentially expressed in pancreatic cancer and potentially regulates glucose metabolism within cancer cells. ECD may also be a transcriptional activator required for the expression of glycolytic genes.

  • Badzek S. et al., 2011, Wien Klin Wochenschr. 123 (23-24): 726-31.
  • Zhao X. et al., 2012, Breast Cancer Res Treat. 134 (1): 171-80.
  • Dey P. et al., 2012, Clin Cancer Res. 18 (22): 6188-98.
  • Size / Price
    Каталог: HG14311-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.